iPSC-derived Striatal Neurons

Striatal neurons

Human iPSC-derived Striatal Neurons

The human striatum receives dopaminergic and glutamatergic inputs from different parts of the central nervous system, and is the primary input nucleus of the basal ganglia. The striatum plays key roles in coordinating various brain functions, including motivation and motor planning. 

The vast majority of human striatal neurons are γ-amino butyric acid (GABAergic) projection medium spiny neurons (MSNs). These cells typically express dopamine- and cAMP-regulated phosphoprotein - DARPP32. It is these cells that specifically degenerate in the early phase of Huntington’s disease (HD) causing progressive loss of the patients' motor and cognitive functions.

Axol has developed a medium formulation that can efficiently drive the differentiation of iPSC-derived neural stem cells to striatal neuronal lineage. The neurons derived using the medium kit are functionally active and express key markers of human MSNs, such as DARPP32, CTIP2, CALBINDIN and GABA.

By using Axol's striatal neuron medium kit with Huntington's disease patient-derived NSCs (ax0211), researchers can build their in vitro HD models with the disease relevant cell type (MSNs) and a real patient genetic background (with 50 GAC repeats).

Striatal neuron culture media and reagents 

Cat. No.  Product Name  Quantity
ax0333
Striatal Neuron Medium Kit 
(For differentiating Axol iPSC-derived NSCs to Striatal Neurons)   
 1 kit: 500 ml basal medium (2 x 250ml); 15 ml supplement (2 x 7.5ml);
1 vial of lyophilized supplement
ax0052 SureBond + ReadySet (For coating culture vessel)  
 1 kit: 3 x 120 μL vials & 2 x 10 mL vials
ax139800   
 Human Brain-derived Neurotrophic Factor (BDNF)    
 10 µg / 100 μg
ax139855   
 Human Glia-derived Neurotrophic Factor (GDNF)  
10 µg / 100 μg
ax68168
 Y-27632 2HCl (ROCK Inhibitor) 
 5 mg

Phase contrast images of differentiating striatal neural culture

iPSC Striatal Neurons

Day 1

 

iPSC Striatal Neurons

Day 7

 

iPSC Striatal Neurons

Day 15

iPSC Medium Spiny Neurons

Day 22

 

iPSC Medium Spiny Neurons

Day 28

 

Medium Spiny Neurons

Day 33

Phase contrast images of Axol Human iPSC-derived Striatal Neurons from 1 day post thawing. Ax0015 NSCs were seeded at 10,000 cells per cm2 (relatively low density for later ICC imaging purpose). These images provide an overview of the health status during striatal differentiation. All images were acquired using the EVOS microscopy using 10X magnification.

Validation of key marker expression by immunocytochemistry

DARPP32 CALBINDIN GABA CTIP2

ICC images of differentiating striatal neural culture. Cells were fixed and stained on day 10, day 18 and day 33 for markers of striatal neurons (medium spiny neurons): DARPP32, CTIP2, CALBINDIN, GABA and MAP2. Download PDF file showing additional ICC images.

Quantitative real time PCR analyses of key marker expression levels

Striatal Medium spiny neuron Q-PCR

Q-PCR analyses of MAP2, CALBINDIN, DARPP-32 and CTIP2 expression levels in Day 33 culture of differentiated striatal neurons. The starting NSC population was seeded at 35,000 cells/cm2 on Day 1. On Day 33, Cells were pelleted, lysed and mRNA were isolated and reverse transcribed to cDNA before Q-PCR reactions. Primer sequences used:

hCalbindin_F TGTGCGAGAAGAATAAACAGGT
hCalbindin_R TAAGAGCAAGATCCGTTCGG

hCTIP2_F CTCCGAGCTCAGGAAAGTGTC
hCTIP2_R ATGAGTGAGGGTGGGAGGAG

hDARPP32_F GAGATGGAGGCTCTGAGGAC
hDARPP32_R GGAAGGGCGCTGAGGTTCCT

hMAP2_F CGAAGCGCCAATGGATTCCC 
hMAP2_R TGAACTATCCTTGCAGACACCT 

Lactate Dehydrogenase (LDH) Cytotoxicity Assay

Significant increase in HD Striatal neuron cytotoxicity

Significant increase in HD Striatal neuron cytotoxicity

Both iPSC-NSCs (ax0015 and ax0211) were seeded at 35,000 cells/cm2 and differentiated to striatal neurons in 96-well plate for 33 days. Cytotoxicity was measured based on LDH (lactate dehydrogenase) release. LDH activity was determined by spectrophotometric absorbance at 490 nm; n=3 (3 wells per condition), along with negative and spontaneous LDH release controls

Kit used: Pierce LDH Cytotoxicity Assay Kit. ThermoFisher Cat. No. 88953

Absorbance normalized to the total protein concentration 

The absorbance was normalised to the protein concentration post lysis (protein concentration was determined using Qubit 2). Normalisation did not change the results since the protein concentration of all samples were comparable.

Striatal Neuron LDH Cytotoxicity Assay

Electrophysiological characterisation using multi-electrode arrays

iPSC-derived NSCs (ax0016) were differentiated to striatal neurons using Axol Striatal Neuron Medium Kit on a 24-well multi-electrode array plate (AlphaMed Scientific Inc.) and spontaneous action potential recordings were carried out and analysed using MED64 Presto system.

Striatal neuron spontaneous field action potential

Spontaneous field action potential (n=5927)

Average Field Potential Duration:  3.66 ms

Average First Peak Amplitude: -16.69 uV

Average Second Peak Amplitude: 9.05 uV

60 second MEA recording

No. of bursts: 913; Burst rate: 1.52 Hz; Mean IntraBurst Interval: 34.96 ms

Frequency – Spike Rate within bursts: 420 Hz; Inter-Burst Interval (time between bursts): 527 ms

Burst First Peak Amplitude within bursts: -16.07 uV

Burst Second Peak Amplitude within bursts: 9.14 uV

Striatal neuron 60 second MEA recording

Resources

  • User Guide: Axol Striatal Neuron Medium Kit
  • For generation of mature functional striatal medium spiny neurons
  • To be used with Axol iPSC-derived NSCs: ax0015, ax0016, ax0018 and/or ax0211

  • Frequently Asked Questions

  • 1. How long do I need to differentiate my NSCs before they are ready for striatal neuron-based assays?

  •     The cells are ready for assaying on day 33. We recommend carrying out striatal neuron-based assay between day 33 and day 40. 


  •

  • 2. How much medium and coating would I need for differentiating a vial (1.5 million cells) of NSCs to striatal neurons (Day 33) ready for assaying?

  •      ReadySet: 12 mL
         SureBond: 90 uL
         Striatal Neuron Medium: 85 mL


  •

  • 3. Can I make up fresh complete medium on a weekly basis?

  •      Yes


  • 4. Have you culture the cells on 96-well plates, if so, which supplier's plate do you recommend for use?

  •    We have differentiated and cultured our iPSC-striatal neurons on Greiner Bio-one's blackwalled 96-well plates (Greiner Item No. 655090)